B&B Organics plans to expand internationally to make traditional organic food available to everyone

July 28: B&B Organics, an organic food products brand, is looking at expanding internationally to make their traditional organic food products available to a broader customer base. The brand is currently operational in India, the USA, and the UK and planning to expand its services to other European countries soon.

Intending to emerge as a global leader in traditional organic food products, B&B Organics focuses on R&D to extract bioactive compounds from traditional food products. They are on a mission to increase the availability of the benefits of the traditional products to the common mass, and people would be able to use the bioactive compounds as supplements in their healthcare regime.

B&B Organics, a brand known for its organic offerings, is a one-of-its-kind organic food products brand that offers traditional food products like rice, millets, sugars, and a variety of other value-added organic products. B&B Organics is the brainchild of S Balaji (B.Tech in Horticulture) and Dr P Balathandayuthabani (PhD in Environmental Sciences – Sweden). They started this brand after identifying the lack of authentic organic traditional food products in the Indian market. As a result, the brand sells high-quality organic food products at affordable prices. In fact, its product portfolio has the highest number of traditional food products than any other company in India, including 75+ varieties of rice, 15+ varieties of millets, 15+ varieties of flakes, and 10+ varieties of sugars, etc.

 

Sharing his vision for the brand, Founder S Balaji said, “The pandemic has made people aware of the importance of a healthy lifestyle. As a result, there has been an increased demand for organic food products in the Indian market. However, there is still a gap in the market in terms of an authentic organic traditional food products brand. B&B Organics is here to fill this gap with its top-notch organic offerings and best-in-industry services. We are on a mission to make people aware of the benefits of organic food habits and bring traditional organic food items within their affordability. We also plan to go global soon to capture international markets and make organic foods a go-to option for people worldwide.”

B&B Organics is a team of responsible and competent men and women. Moreover, it aims to emerge as a company run by women in the coming times. Since 2016, long before Corona, the brand has been offering work from home to encourage and support its women employees. Women on Wings, an organization headquartered in Netherland, will collaborate with the firm due to its support for women employees. Additionally, the brand envisions sharing a percentage of its profit with its farmers.

As there is an increased awareness of quality and organic food eating habits among people in the post-pandemic world, B&B Organics is determined to make organic food available to everyone.

For more details, Visit www.bnborganics.com +91- 99434 77454

If you have any objection to this press release content, kindly contact pr.error.rectification@gmail.com to notify us. We will respond and rectify the situation in the next 24 hours.

 

 

 

 

 

 

 

 

 

 

 

 

18 thoughts on “B&B Organics plans to expand internationally to make traditional organic food available to everyone

  1. However, we could not exclude the possibility that the cimetidine induced vascular damage could be caused by possible cimetidine induced LC injuries or both concomitantly lasix iv to po Hence the patient s airway should be assessed carefully for the ease of ventilation and tracheal intubation, in consideration with specific surgical needs such as hemodynamic stability and spinal immobilization

  2. clomid otc The 5 probe which recognizes both the wildtype gene and transgene was amplified from BAC using the following primers Avil5HS GACGGCGCGCCCTCAGGAATATG TGTTGCCTTTC; Avil5HAS TCTGTCGACCATAGTGGCTGTCTTCCTGGAAC

Leave a Reply

Your email address will not be published.

Releated

Meet 10 Rapidly Growing Indian Companies Making an Impact in 2023

New Delhi (India), March 27: India is one of the most resourceful countries in the world. With its huge population and infinite talent in action, the flourishing economy is revolutionizing every field of work, creating a space that focuses on developing resources to a higher extent. Indian companies have been dominating the market lately. The […]

ChocoCraft Completes 10 Years of Business

New Delhi (India), March 27: ChocoCraft, a leading manufacturer of personalised chocolates, has completed 10 years of successful business operations. The company was founded in 2013 with a mission to provide high-quality, customized chocolates that are unique and memorable. Over the years, ChocoCraft has grown to become a well-known brand in the gifting industry, catering […]