CEO’s Summit 2023 by Indian Plumbing Association provides impetus for future strategy discussions among stakeholders in the building industry

Bangalore (Karnataka) (India), January 25: The CEO’s SUMMIT 2023 on “Make for India in Built Environment” was held at the Mysore Hall, ITC Gardenia, Bengaluru on 20th January 2023. The premium event was visited by leading architects, builders & MEP Consultants, senior leadership from Plumbing product manufacturers, etc. The event was organized by Indian Plumbing Association (IPA) on the completion of its 30 years of service to the nation.

The event offered a collaborative environment for the industry stakeholders to plan for future growth strategies alongside nurturing purposeful networking & engagements. It underlined the importance of focusing on building performance rather than just CAPEX, as this can lead to a visible shift towards increased sustainability in our built environment.

The event has a panel discussion and an open house discussion. The panel discussion on Modular Construction was moderated by Arch. V. ‘Naresh’ Narasimhan, Venkataramanan Associates where the experts from architects and consultants participated as panelists- G. H. Basavaraj ( Chetana Group), a builder, Arch. V. Vishwanath, (YV Architects)an architect, A N Prakash( A. N. Prakash Construction Project Management Consultants)a consultant, Arch. Dinesh Verma ( ACE Group Architects) an architect, and Prasanna Venkatesh G, (Sobha Ltd.) a builder.

In the panel discussion, all the experts echoed that in any given project, the spotlight should be on sustainability with a clearly defined roadmap to optimize long-term maintenance costs.

Moderator, Mr. V. Naresh Narasimhan, quoted “Prefab, Modular Construction is the trick to create built houses for the vast lot of the Indian Population that we want to cater to”

“The prefab material can shorten the construction cycle, lower the overall cost of production, and can be instrumental in reducing the carbon footprint. Consequently, major developers are now embracing the idea of prefab materials and construction techniques” He further added.

After this, an open house discussion on Sustainability in Buildings took place which was moderated by Gurmit Singh Arora, National President, IPA, and National Chairman, of CII IGBC. Builders, architects, and the MEP Consultant fraternity participated in this Open House.

The open house emphasized Net Zero Water to optimize annual water consumption. It further suggested the pressing need for builders and the architect fraternity to start the movement towards renewable energy in buildings.

Mr. Gurmit Singh Arora quoted “As designers, consultants, architects, and builders we need to make conscious efforts to move towards sustainability in all built environments”.

As imparting value-driven knowledge has always been the cornerstone of IPA events, the Summit 2023 saw the launch of Plumb Talk, an IPA video series based on Chapters of AGGPP (A Guide to Good Plumbing Practices). The series was launched with the first video being broadcasted on YouTube. 1st Plumb Talk video is on Plumbing Terminologies and Every month one video based on a Chapter will be released on YouTube, having a Plumbing expert articulating a topic and explaining it in a comprehensible manner. This will help any common man, be it from an engineering or an architecture background to understand the basics of plumbing.

If you have any objection to this press release content, kindly contact pr.error.rectification[at] to notify us. We will respond and rectify the situation in the next 24 hours.

23 thoughts on “CEO’s Summit 2023 by Indian Plumbing Association provides impetus for future strategy discussions among stakeholders in the building industry

  1. The promoter fragments of IGFBP3 160 1414, 160, 5 AAACTCGAGGCATTCGTGTGTACCTCGTG 3; 1414, 5 CCCGAGCTCTGATCTTCCCCTGTCCACTC 3, HIF 1a 80 1871, 80, 5 AAACTCGAGCTCTCCTCAGGTGGCTTGTC 3; 1871, 5 CCCGAGCTCGAGTTGCAGTGAGCCGAAAT 3, and HIF 2a 46 1222, 46, 5 AAACTCGAGGAGGACAAGCTGGCAGAGAC 3; 1222, 5 CCCGAGCTCGTGTTCCGCATTTTGGAAGT 3 were generated by chromosomal DNA extraction from P0, amplified by Q5 High Fidelity DNA Polymerase NEB, Ipswich, MA, USA, and constructed into pGL3 Promega, Madison, WI, USA stromectol japan Endocrinology 87, 542 551 1970

Leave a Reply

Your email address will not be published.


Budget a step towards making India a superpower as well as self-reliant – Mr. Alpesh Purohit, Director, Pinnacle Credit Advisors Pvt Ltd

Alpesh Purohit, Director, Pinnacle Credit Advisors Pvt Ltd New Delhi (India), February 6: The union budget 2023 emphasises mainly 3 pillars – Capex Boost, Fiscal Prudence and Income tax reforms. The budget has no negative surprises on any front. The budget focuses largely towards fostering investments in the infrastructure and manufacturing sector with an aim […]